This website uses cookies to ensure you get the best experience on our website.
- Table of Contents
1 Citations 1 Q&As
2 Citations 7 Q&As
11 Q&As
Facts about Fatty acid-binding protein, intestinal.
Binds saturated long-chain fatty acids with a high affinity, but binds with a lower affinity to unsaturated long- chain fatty acids. FABP2 may also help maintain energy homeostasis by functioning as a lipid sensor.
Human | |
---|---|
Gene Name: | FABP2 |
Uniprot: | P12104 |
Entrez: | 2169 |
Belongs to: |
---|
calycin superfamily |
FABP2; FABPI; fatty acid binding protein 2, intestinal; Fatty acid-binding protein 2; fatty acid-binding protein, intestinal; IFABP; I-FABP; I-FABPMGC133132; Intestinal FABP; Intestinal-type fatty acid-binding protein
Mass (kDA):
15.207 kDA
Human | |
---|---|
Location: | 4q26 |
Sequence: | 4; NC_000004.12 (119317250..119322138, complement) |
Expressed in the small intestine and at much lower levels in the large intestine. Highest expression levels in the jejunum.
Cytoplasm.
In this article, we'll go over the advantages of Boster Bio's Anti-Intestinal FaBP/FABP2 Marker, and look at the basic principles of ELISA, validation, and applications. The Boster Bio Anti Intestinal FABP/FABP2 marker can ultimately benefit you. Let's get started! Continue reading to find out more
This antibody reacts to human, mouse and rat FABP proteins and is a part of the Picoband(tm) catalog. Boster has been manufacturing antibodies for more than 25 years. Their antibodies are aimed at monitoring specific proteins in the body. Boster Bio Anti-Intestinal FABP/FABP2 Marker is a good option for this.
The protein encoded by FABP2 is tiny cytoplasmic with four exons. It is highly expressed in the epithelial cells of the small intestine. It belongs to a multigene group that comprises several proteins with an approximate 14-15 kDa weight. The FABP2 protein is involved in many biological processes such as intracellular metabolism, uptake transport of long-chain fat acids, and cell proliferation.
ELISA is a method used to detect proteins in biological samples. Detection occurs through the addition of a substrate to the reagent. There are a myriad of substrates to choose from like hydrogen peroxide, as well as alkaline phosphatase. The latter is preferred for its ability to determine the yellow color of nitrophenol.
Indirect ELISA, however, relies on secondary antibodies to deliver the signal. This antibody recognizes the constant (Fc) region of the primary antibody. The primary antibody is, however is expensive and precious, whereas secondary antibodies are cheap and easily produced. The combination of monoclonal primary antibody and polyclonal secondary antibodies increases the sensitivity and the specificity. Each polyclonal antibody recognizes an epitope independently and is composed of multiple Clones. They may bind to multiple locations in the Fc region of primary antibodies.
FABP2 markers are derived from the cytoplasmic lip transporter FABP2. They bind to triglyceride-rich lipoproteins and are believed to play a role in energy homeostasis. Certain FABP polymorphisms have also been associated with lipid metabolism disorders such as atherosclerosis. FABP2 ELISA is an excellent method to identify this marker in biological samples.
The ELISA method utilizes multi-well plates. The detection antibody recognizes the antigen of interest while the capture antibody is able to immobilize it in the samples. The detection molecule, usually streptavidin HRP, is then bound to the capture antibody. The product that is produced is colored and correlated with the concentration of the analyte present in the original sample. For example darker wells indicate higher levels of proteins that are targeted.
The quality of the sample will determine the ability of an ELISA. Polyclonal antibodies are more suitable for complex samples than monoclonal ones that may have low concentrations. Testing with empirical methods will determine which clonality is the best. This can be determined by comparing the concentrations of the antigens in the samples. It is also important to consider the clonality of the detection antibody.
The validation of the FABP2 marker was performed in two groups. In the first group, a 1057-bp fragment located upstream of FABP2 promoter was sequenced using the terminator cycle sequencing method. The primer sequences used were 5'GCTTCTTTCCTGACCT'3 and 5'ACAGCTGGAGTCTCTCAAAA'3.
The second group consisted of patients suffering from CKD and pre-hemodialysis ESRD. Interestingly, FABP2 levels were higher among patients who had normal renal function. Therefore, validation of the FABP2 marker in these patients could aid in the diagnosis of renal insufficiency. The results of this study show that the FABP2 marker can be used as a marker for diagnosis in chronic kidney disease.
The results revealed that FABP2 expression was inversely related to genotype subgroups. Specifically, the B-allele carriers had an r-value of -0.47 while the Ala54Ala and Thr54-allele carriers showed an R-value of -0.33. These results suggest that FABP2 expression may affect the other. For example, FABP2 expression is associated with the metabolic state of human beings who suffer from lipid-malabsorption syndromes.
The relationship between FABP2 expression and dietary influences was examined using two nested coefficient models. The results of both models were comparable, but significant interactions were observed when comparing Thr54-allele carriers and Ala54-Alla homozygotes. The expression of FABP2 was affected by (n-3)FA intake. After controlling for (n-3)FA intake, the connection between promoter haplotypes and FABP2 expression was significant. This was even after adjusting for age and gender.
Research in the past has revealed that FABP2 gene polymorphisms are linked to fat assimilation rate as well as postprandial cholesterol. The FABP2 gene is a suitable candidate gene for diabetes. It could also function as a specific marker for tissue. The phenotype of the FABP2 gene as well as its sequence, could prove beneficial in clinical research. The protein also functions as a lipid detector in the gut.
Further research has confirmed that FABP1 can be used as a marker for CKD. In fact, several studies on animals and human clinical studies have confirmed the efficacy of FABP1 in diagnosing CKD. Panduru et al. found FABP1 to be a reliable indicator of diabetic kidney disease in humans. Furthermore, Mou et al. observed a correlation between urinary FABP1 and glomerulosclerosis, suggesting FABP1 could serve as a biomarker for CKD.
The regulation of FA absorption is controlled by the FABP2 gene product. It was recently identified as a candidate gene to cause insulin resistance. Numerous studies have shown that insulin resistance could be caused by defects in FA regulation. However, further studies must be conducted to verify these theories. The FABP2 gene product hasn't been thoroughly investigated. The gene product is connected to various diseases such as diabetes, Alzheimer's, cancer and even Alzheimer's.
FABP2 is made of 131 amino acids and has a molecular weight of 15 kDa. The protein's shape is a semi-flattened cylindrical. The body consists of a pair of antiparallel b-strands that make up a b barrel-like structure. Two a-helices enclose one end of the barrel. The ligand-binding region of the inside cavity of the bbarrel is situated inside the b-barrel. FABP2 can lock one molecule of ligand.
The third structure of a protein is closely connected to its biological function. FABP2 is a small intracellular polypeptide that is involved in the process of metabolizing fatty acids and transport. The FABP2 gene encodes an enterocyte-specific protein. It serves many functions such as metabolism, transport and energy homeostasis. The Pigeon FABP2 protein is a b-barrel that contains a N-terminal motif with a helix-turn motif.
Numerous studies have demonstrated the benefits of FABP2 SNPs in the gene for a variety of human illnesses. The bird's FABP2 gene is in a large way related to human diseases. While studies on FABP2 SNPs in human genes have focused on the disease in humans, poultry and livestock have not been extensively studied. However BLAST analysis and a direct sequence have revealed pigeon FABP2 homologous genes.
PMID: 2824476 by Sweetser D.A., et al. The human and rodent intestinal fatty acid binding protein genes. A comparative analysis of their structure, expression, and linkage relationships.
PMID: 14563446 by Pelsers M.M.A.L., et al. Intestinal-type and liver-type fatty acid-binding protein in the intestine. Tissue distribution and clinical utility.
*More publications can be found for each product on its corresponding product page