BMI1 Antibodies

Polycomb complex protein BMI-1 (BMI1)

Component of a Polycomb group (PcG) multiprotein PRC1- like complex, a complex class required to keep the transcriptionally repressive state of many genes, including Hox genes, during development. PcG PRC1 complex acts through chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A'Lys-119', rendering chromatin heritably changed in its expressibility (PubMed:15386022, PubMed:16359901, PubMed:26151332, PubMed:16714294, PubMed:21772249, PubMed:25355358, PubMed:27827373).

The complex composed of RNF2, UB2D3 and BMI1 binds nucleosomes, also contains action only with nucleosomal histone H2A (PubMed:21772249, PubMed:25355358). From the PRC1-like complex, regulates the E3 ubiquitin-protein ligase activity of RNF2/RING2 (PubMed:15386022, PubMed:26151332, PubMed:21772249).

Gene Information

Human
Gene Name:	BMI1
Uniprot:	P35226
Entrez:	648

Family

Belongs to:
No superfamily

Alternative Names

B lymphoma Mo-MLV insertion region 1 homolog (mouse); B lymphoma Mo-MLV insertion region 1 homolog; BMI1 polycomb ring finger oncogene; BMI1; BMI-1; FLVI2/BMI1; MGC12685; murine leukemia viral (bmi-1) oncogene homolog; PCGF4; polycomb complex protein BMI-1; polycomb group protein Bmi1; polycomb group ring finger 4; RING finger protein 51; RNF51; RNF51Polycomb group RING finger protein 4

Molecular Weight

Mass (kDA):
36.949 kDA

Genomic Context

Human
Location:	10p12.2
Sequence:	10; NC_000010.11 (22321099..22331484)

Subcellular Localizations

Nucleus. Cytoplasm.

Diseases

• Neoplasms
• Malignant Neoplasms
• Cell Transformation, Neoplastic
• Carcinoma
• Leukemia
• Malignant Paraganglionic Neoplasm
• Neoplasm Metastasis
• Lymphoma
• Malignant Neoplasm Of Breast
• Myeloid Leukemia
• Mammary Neoplasms
• Malignant Squamous Cell Neoplasm

• Brain Neoplasms
• Cell Invasion
• Carcinogenesis
• Leukemia, Myelocytic, Acute
• Neoplasm Invasiveness
• Lung Neoplasms

Interacting Proteins

• CBX4
• CBX6
• CBX7
• CBX8
• MOV10

• NDEL1
• PHC1
• PHC2
• PTEN
• RING1

• RNF2
• UBC
• USP11
• USP7
• VPS11

Pathways

• Senescence
• Cell Cycle
• Cell Proliferation
• Methylation
• Pathogenesis
• Cell Growth
• Oncogenesis
• Cell Differentiation
• Gene Silencing
• Cellular Senescence
• Localization
• Regeneration
• Rna Interference

• Cell Death
• Aging
• Dna Methylation
• Replicative Senescence
• Drug Resistance
• Dna Repair
• Stem Cell Maintenance

PTMs

• Methylation
• Phosphorylation
• Ubiquitination
• Acetylation
• Demethylation

• Cleavage
• Deacetylation
• Reduction
• Dephosphorylation
• Sumoylation

Research Areas

• Breast Cancer
• Cancer
• Cell Biology
• Cell Cycle and Replication
• Chromatin Research

• DNA Repair
• DNA replication, Transcription, Translation and Splicing
• Hematopoietic Stem Cell Markers
• Stem Cell Markers
• Transcription Factors and Regulators

For details, visit:
bosterbio.com/bosterbio-gene-info-cards/BMI1

Best Uses of the BMI1 Marker

The best use of the BMI1 marker for research is in the diagnosis of metabolic diseases. Several factors can determine the BMI1 marker's usefulness. The following paragraphs discuss its validation, availability, and usage. This article is aimed at helping researchers make informed decisions about the BMI1 marker. The BMI1 marker is a protein that binds to the BMI1 immunogen. It is present in the serum and tissue of obese or overweight people.

Anti-Bmi1 Marker

There are several antibodies available to detect Bmi-1. SALL4 has shown strong binding to Bmi-1 promoter regions and is capable of modulating levels of endogenous Bmi-1 expression. However, SALL4 isoforms differ in their ability to bind to cis-regulatory elements. Interestingly, both SALL4B and SALL4 exhibit high binding affinity to cis-regulatory elements of Bmi-1, and this finding may suggest a novel link between SALL4 and Bmi-1.

In addition to regulating chemoresistance of MM cells, BMI1 is also important for the expression of some cell surface molecules. This may result in increased VEGF and MMP231 levels, two markers of endothelial cells that regulate tumor angiogenesis. However, BMI1 is not required for active cell proliferation. In fact, BMI1-KO MM cells lost pro-myeloma features.

Although not fully understood, the functions of Bmi1 remain unclear. It is an oncogene that regulates cell cycle and represses the tumor suppressor p16. The protein also acts on other cell types, such as lymphoma and hepatic cancer. It is therefore important to understand its role in different types of cancer. This antibody targets Bmi1 to investigate its role in a wide range of tumor types.

The anti-BMI1 antibody is highly effective against hepatocellular carcinoma. The mechanism by which it inhibits cancer growth has not yet been fully understood, but the evidence that it is an important therapeutic target supports the concept. In mice, Bmi1 knockdown inhibits HCC cell growth by blocking the cell cycle transition from G1/S phase to the S phase, increasing tumor-bearing mice's survival time from sixteen to 24 days.

Validation

A recent study has validated the Bmi1 marker. In humans, knockdown of Bmi1 expression inhibits the growth of HCC cells during fast-growing periods. Further, it has shown promise as a therapeutic target for hepatocellular carcinoma. However, more research is required to understand its impact on the development of cardiovascular therapies. This article will briefly review the current status of Bmi1 validation.

Moreover, the Bmi-1 gene has been found to be expressed more in tumors than in non-cancerous tissues. Overexpression of Bmi-1 increases tumorigenic potential by repressing epithelial marker expression and upregulating mesenchymal markers. Knockdown of Bmi-1 inhibits tumorigenesis and restores the expression of E-cadherin and b-Catenin in MDA-MB-435S cells.

BMI1 is an important member of the PRC1 family, a protein involved in regulating the growth and survival of stem cells. Its expression in tumors correlates with tumor growth, metastasis, and chemo-resistance. It is also present in cardiac stem cells, a key regulatory factor in cardiac pathology. Although BMI1 is involved in tumorigenesis, it also has important roles in cardiovascular disorders, including ischemic heart disease.

Real-time PCR was used to determine the expression levels of Bmi-1. Using an ABI PRISM 7500 Sequence Detection System, amplifications of Bmi-1 were performed in triplicate repeats in two independent experiments. The geometric mean of GAPDH housekeeping gene served as an internal control. As the Bmi-1 primer, 5-'CTGGTTGCCCAAGT'-G, and the E-cadherin primer, 'CGAGTTGGTTTGTCGGATGTGGTC'-3'-P,' were used.

In a recent study, Dimri GP and Silva J investigated the role of Bmi-1 oncoprotein in primary and metastatic breast cancer. The researchers also studied Hpc-2 and Mel-18 in breast cancer, as well as the Bmi-1 oncogene in the latter type. Moreover, they found that suppressing Bmi-1 reduced lung metastases and the expression of b-Catenin was upregulated in the shBmi-12# group.

Usage

The BMI1 marker is a member of the PRC1 family and maintains the proliferation and self-renewal of stem cells. It is abundantly expressed in malignant tumors, where it serves as a key regulator of the tumorigenic process. Its expression in terminally differentiated organs is relatively unknown. However, emerging evidence suggests that Bmi1 is expressed in heart tissue and exerts profound effects on cardiac pathology.

The usage of the BMI1 marker has the potential to help develop novel therapeutics for breast cancer. The expression of BMI1 is known to be regulated after treatment of certain forms of cancer, and manipulation of this marker may aid in developing drugs to treat the disease. The use of BMI1 in cancer research is not limited to clinical trials, however. Scientists have studied the impact of this marker on cardiac therapies and the design of future clinical trials.

Availability

The availability of the BMI1 marker in Boster bio is a boon for researchers working on neural differentiation. This marker is specifically expressed in neural stem cells. By regulating neural differentiation in mouse iPSCs, Bmi1 is a valuable tool for regenerative medicine, disease modeling, and neuronal development. In addition, the Bmi1 gene can be used to identify individualized therapeutic compounds.

As a biomarker for the heart, the BMI1 gene has many important functions in the cardiovascular system. In fact, Bmi1 is a key epigenetic regulator. When inhibited, it can lead to significant chromatin status perturbation and trans-differentiation. Thus, the BMI1 marker is important for research in cardiovascular disease. But, there is more to BMI1 than meets the eye.

In addition, the BMI1 gene is involved in the development of cancer stem cells. It is a tumor suppressor and plays an important role in cell proliferation and differentiation. Furthermore, tumors enriched in Bmi1 have poor prognoses. Availability of the BMI1 marker in Boster Bio can be a boon for cancer researchers who wish to monitor these cells and their tumor progression.

The BMI1 antibody is manufactured by Boster Bio and has a shelf life of one year. It is shipped from their facilities in PBS containing 0.09% sodium azide and can be stored at -20degC or 4degC. The BMI1 antibody reacts with Human, Rat, and Mouse. The antibodies are produced using rabbits immunized with synthetic peptides between 281-314 amino acids.

Pricing

The BMI1 gene belongs to the polycomb family of proteins. They function as transcriptional repressors in many different cell types. The Bmi1 gene is an important cancer stem cell marker, because it plays a role in tumor initiation, progression, invasion, metastasis, and recurrence. Lack of reliable markers is a significant limitation in the development of new anticancer strategies.